TRUE/FALSE. as the tubular filtrate moves through the descending limb of the nephron loop, water leaves and the solute concentration of the filtrate increases.

Question

05-12-2022
Biology

Answered

TRUE/FALSE. as the tubular filtrate moves through the descending limb of the nephron loop, water leaves and the solute concentration of the filtrate increases.

Answer :

Other Questions

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

With the concept of CHANGING- ENVIRONMENT HYPOTHESIS in mind, what could be the possible explanation why the frequency of meiosis in protists increases when the

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

What is the difference between head and tails of a phospholipid are?; Do phospholipid tails attract water?; What attracts water in the cell membrane?; What is t

Which sentence best describes the origin of the kinetic energy used to make ATP from ADP and phosphate groups? A. ADP molecules flow through ATP synthase and co

the enterotoxin of the bacterium clostridium perfringens upregulates the expression of human claudins, including cldn6. given the information in the passage, ho

the diploid number of chromosomes in the cell of a domesticated dog is 78. which of the following options include.___after fertilziaton.

The table lists the speed of light in four different materials at the same temperature. OA. Water OB. Diamond OC. Glass Material Quartz 195,000,000 Diamond 125,

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

abhinavjh321 abhinavjh321 · Answer 1 · 2022-12-08T13:37:32-05:00

It is true that the tubular filtrate moves through the descending limb of the nephron loop, water leaves, and the solute concentration of the filtrate increases.

Water passively exits the filtrate as it descends the descending limb of the loop of Henle and passes through areas of the nephron with a more concentrated interstitial fluid. The water will passively flow out of the filtrate and into the interstitium because water always moves from areas of high water concentration (low osmolarity) to those of low water concentration (high osmolarity).

The filtrate travels via the narrow ascending limb of the Henle loop, which is permeable to ions but impervious to water. Sodium passively moves down its concentration gradient from the filtrate to the interstitial fluid when the leg moves through less concentrated regions of the nephron. Water is not actively transferred at any time throughout this procedure.

To learn more about nephron click on the below link:

https://brainly.com/question/242658

#SPJ4