gemtoca gemtoca

03-01-2023
Biology

Answered

With the concept of CHANGING- ENVIRONMENT HYPOTHESIS in mind, what could be the possible explanation why the frequency of meiosis in protists increases when there is food scarcity or when the density in population is high?

Answer :

Other Questions

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

3. The table below shows factors that could be present in a population. Next to each factor, write whether this would cause natural selection or not. (5 points

Sort the following list so that the stages of meiosis 1 appear in order. Remember You start with 1 cell and end with 2 cells

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

Based on this kind of biogeographical evidence, a scientist might propose the following hypothesis: The common ancestor of the cactus family evolved in the area

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

. Look up current ocean pH values. How do the current values compare to those from previous years? ((my answer: 8.1 pH today and 8.2 pH previously (slightly bas

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).