which of the following would be consistent with the idea that a human disease has a genetic component?a. It has a particular age of onset.b. It is less likely to occur in relatives living apart than in relatives living together.c. A correlation is found between the presence of a mutation in a particular gene and the occurrence of the disease.d. All of the above are consistent.

Question

05-12-2022
Biology

Answered

which of the following would be consistent with the idea that a human disease has a genetic component?a. It has a particular age of onset.b. It is less likely to occur in relatives living apart than in relatives living together.c. A correlation is found between the presence of a mutation in a particular gene and the occurrence of the disease.d. All of the above are consistent.

Answer :

Other Questions

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

amar is making a cladogram. out of all the species he is using, he knows that species x and y are the least primitive and are the most closely related.where wil

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

routine monitoring of water in a reservoir has found a high count of e. coli. of the following, you would be most concerned that the contaminated water might al

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

based on the antibiotic-resistant bacteria lab, which of the following mechanisms of change in gene frequencies is responsible for the antibiotic resistance of

Paruljain Paruljain · Answer 1 · 2022-12-07T16:03:34-05:00

Option (d) i.e. All of the above are consistent with the idea that a human disease has a genetic component.

Cells serve as the primary structural and functional building elements of every known living creature. The instructions needed to regulate activities are encoded in the DNA (deoxyribonucleic acid) sequence. The four basic components of DNA, adenine, thymine, guanine, and cytosine, also known as A, T, G, and C, are present in all living things. Complementary DNA strands are created when A pairs with T and C pairs with G. The chromosomes, which are physically different molecules with lengths varying from 50 to 250 million base pairs, make up the human genome, which is the entirety of the genetic material in a cell. Human cells contain two sets of chromosomes, one pair of which is inherited from each parent. 22 autosomes and 23 pairs of chromosomes are typically present in each cell (numbered 1 through 22). The many genes found on each chromosome are the fundamental structural and functional components of heredity genetic. The precise base pairing along the DNA strand, known as the DNA sequence (e.g., ATTCCGGA).

To know more about genetic please refer: https://brainly.com/question/12985618

#SPJ4