In a certain population, D is a dominant, wild-type allele of a gene encoding a protein important for cell division, and d is a recessive, loss- of-function allele of that gene. The allele frequencies for this gene in this popoulation are D = .7, d = .3 If mutation is the only force acting on this population from generation to generation, what do you predict will happen to allele frequencies over successive generations? The frequency of the D allele will increase The frequency of the d allele will increase Allele frequencies will remain constant

Question

05-12-2022
Biology

Answered

In a certain population, D is a dominant, wild-type allele of a gene encoding a protein important for cell division, and d is a recessive, loss- of-function allele of that gene. The allele frequencies for this gene in this popoulation are D = .7, d = .3 If mutation is the only force acting on this population from generation to generation, what do you predict will happen to allele frequencies over successive generations? The frequency of the D allele will increase The frequency of the d allele will increase Allele frequencies will remain constant

Answer :

Other Questions

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

based on the antibiotic-resistant bacteria lab, which of the following mechanisms of change in gene frequencies is responsible for the antibiotic resistance of

the trait represented by the colored circles and squares below is inherited as a dominant allele. this is not a sex-linked trait. shaded individual show the dom

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

a botanist studied a population of grasses in an area of erratic rainfall. she found that plants with curled leaves reproduced better in dry years, and those wi

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

abhinavjh321 abhinavjh321 · Answer 1 · 2022-12-09T03:05:20-05:00

Over several generations, the D allele's frequency will increase.

An allele, or DNA variant, that is more common than 1% in a group and determines the phenotype that is most frequently seen there. A superscript "plus" sign (+) is frequently used to identify wild-type alleles from mutant alleles. In the circumstances of haploinsufficiency, over-expression, misexpression, and creation of an unsuitable (toxic) product, mutant alleles can be dominant to wild type alleles. A protein produced by the KRAS gene participates in cell signaling pathways that regulate cell proliferation, cell maturation, and cell death. Wild-type alleles are denoted by a superscript "+," for as w+ for red eyes and vg+ for full-size wings.

To learn more about wild-type allele click here https://brainly.com/question/15908514

#SPJ4