williamsdre3352 williamsdre3352

23-12-2022
Biology

Answered

the trait represented by the colored circles and squares below is inherited as a dominant allele. this is not a sex-linked trait. shaded individual show the dominant trait

Answer :

Other Questions

in fruit flies red eye color (R) is dominant to white eyes (r) in a cross between two flies, 50% of the male and 50% of the female offspring had red eyes. The o

gray seed color in peas is dominant to white. assume that mendel conducted a series of experiments where plants with gray seeds were crossed among themselves, a

18. in fruit flies, brown bodies (b) are dominant to black bodies (b). cross a black fruit fly with a heterozygous fruit fly. determine the phenotypic and genot

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

after completing the animation, briefly report your findings. list each organelle, where you found it in the cell, and what its primary function is. write your

the arctic tundra has remained frozen for thousands of years but is slowing thawing as global temperatures increase. once thawed, the environment and ecosystems

the age pyramid below shows the age structure or a mystery population or animal. this animal reaches sexual maturity very early in life, and this population's s

refer to the drawings in teh gifureg below of aisngle pair of homologous chromsomes as they migh appear during varius stages of eitehr mtisois or meisois, and a