Jocyeln4899 Jocyeln4899

05-12-2022
Biology

Answered

Which of the following statements most accurately describes the expression of the repressor protein of the tryptophan operon? Choose one: The gene for the tryptophan repressor is turned on in response to high levels of tryptophan in the cell. The gene for the tryptophan repressor is turned off in response to high levels of tryptophan in the cell. The gene for the tryptophan repressor is turned on in response to low levels of tryptophan in the cell. The gene for the tryptophan repressor is turned off in response to low levels of tryptophan in the cell. The gene for the tryptophan repressor is expressed constitutively.

Answer :

kumarravichandra kumarravichandra

08-12-2022

the following statements most accurately describes the expression of the repressor protein of the tryptophan operon

The gene for the tryptophan repressor is expressed constitutively.

The formation and maintenance of the body's proteins, muscles, enzymes, and neurotransmitters depend on the amino acid tryptophan, which is also necessary for infants' optimal growth. This amino acid is necessary. As a result, you must obtain it from your diet since your body cannot create it.

Function

Tryptophan is a building block for serotonin and melatonin in the body. Serotonin is known to assist control mood, pain, sleep, and appetite, and melatonin aids in regulating the sleep-wake cycle.

Niacin, a vitamin B3 required for DNA synthesis and energy metabolism, can also be produced by the liver using tryptophan. The body requires the following things for tryptophan in the diet to convert to niacin:

Iron

Riboflavin

B6 vitamin

Learn more about tryptophan here:

https://brainly.com/question/29434320

#SPJ4

Answer Link

Other Questions

operon operator repressor regulatory gene corepressor trp operon tryptophan lac operon allolactose inducible operon vs. repressible operon activator inducer cyc

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

based on the antibiotic-resistant bacteria lab, which of the following mechanisms of change in gene frequencies is responsible for the antibiotic resistance of

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).