select the statement that best describes the effectiveness of vaccination in the older adult population. a) Elderly persons who are immunized have the same effective response in immunity as younger persons do. b) Experimental evidence suggests that vaccination is less successful in inducing immunization in older persons than in younger adults. c) Vaccinations are only effective in the elderly populations if their families have been vaccinated. d) Age does not influence the effectiveness;

Question

05-12-2022
Biology

Answered

select the statement that best describes the effectiveness of vaccination in the older adult population. a) Elderly persons who are immunized have the same effective response in immunity as younger persons do. b) Experimental evidence suggests that vaccination is less successful in inducing immunization in older persons than in younger adults. c) Vaccinations are only effective in the elderly populations if their families have been vaccinated. d) Age does not influence the effectiveness;

Answer :

Other Questions

a botanist studied a population of grasses in an area of erratic rainfall. she found that plants with curled leaves reproduced better in dry years, and those wi

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

variegated limpets are a different species from olive limpets. they live on the same rocky benches along the same sea shore, and eat the same kinds of foods. th

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

g you have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove thei

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

kumarravichandra kumarravichandra · Answer 1 · 2022-12-08T04:37:09-05:00

the statement that best describes the effectiveness of vaccination in the older adult population Age does not influence the effectiveness.

The WHO advises the use of BNT162b2 in pregnant people due to the harmful effects of COVID-19 disease during pregnancy and the growing body of evidence demonstrating a good safety profile of BNT162b2 in pregnancy. Pregnancy testing is not advised by the WHO before vaccination. The WHO does not advise delaying or ending pregnancies due to vaccination.

The effectiveness of vaccines is anticipated to be comparable in breastfeeding women and other adults. As with other people, the WHO advises vaccination of nursing mothers. WHO does not advise stopping nursing due to immunization. Following vaccination of breastfeeding women, vaccine-elicited antibodies have been discovered in breast milk, suggesting potential neonatal as well as maternal protection.

learn more about vaccination here:

https://brainly.com/question/29570766

#SPJ4