a crater believed to be the one caused by the end-cretaceous bolide was found in group of answer choices

Question

05-12-2022
Biology

Answered

a crater believed to be the one caused by the end-cretaceous bolide was found in group of answer choices

Answer :

Other Questions

which of the listed local anesthetics could produce an emergency situation characterized by the inability of the blood to bind to oxygen? group of answer choice

Part B: Construct a Dichotomous Key You will be working with a group of organisms such as snails, birds, antelopes, rodents, or aquarium fish. You will need to

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

Type the correct answer in each box

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

A somatic mutation is: a. heritable b. always harmful c. always caused by a mutagen d. none of the options listed here

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

ASAP I can’t find the textbook answer

ASAP I can’t find the textbook answer!!

abhinavjh321 abhinavjh321 · Answer 1 · 2022-12-07T11:17:45-05:00

The Yucatan Peninsula is to be a crater left by the end-cretaceous bolide was a rapid global extinction that occurred 66 million years ago that affected 75 percent of all plant and animal species on Earth.

The Mexican states of Yucatan, Campeche, and Quintana Roo are located on the peninsula itself. It also includes crater Belize's and Guatemala's northern regions. The Yucatan Peninsula is well-known for having tropical jungles and rainforests as well as for being the Maya people's original homeland. One of the safest areas to travel in Mexico is Yucatan. I mostly concur as a crater solitary female traveler with over a year of experience exploring the "A crater on the Yucatan Peninsula thought to have been created by an end-cretaceous bolide was discovered." I'll use data and my own experience to help you understand safety in the Yucatan.

learn more about crater here:

https://brainly.com/question/3028023

#SPJ4