briarwilliams6800 briarwilliams6800

23-12-2022
Biology

Answered

A somatic mutation is: a. heritable b. always harmful c. always caused by a mutagen d. none of the options listed here

Answer :

Other Questions

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

g you have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove thei

g ou have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove their

Imagine you are a grape farmer you grow black grapes one day you notice that one of the grape vines that is growing in your arbor which has always produced balc

DRAW IT : The graph here shows the pH difference across the inner mitochondrial membrane over time in an active respiring cell. At the time indicated by the ver

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

True/False mineral nutrients are cycled through ecosystems and their environment. water, carbon, nitrogen, phosphorus and sulfur are of particular importance. h