which of the following statements is true? the leading strand is replicated continuously for the entire length of the chromosome, e.g. while the lagging strand has multiple origins of replication.

Question

05-12-2022
Biology

Answered

which of the following statements is true? the leading strand is replicated continuously for the entire length of the chromosome, e.g. while the lagging strand has multiple origins of replication.

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

When phage nucleic acid is incorporated into the nucleic acid of its host cell and is replicated when the host DNA is replicated, this is considered part of whi

which of the following is thought to have been the first step in the origin of life? group of answer choices replication of primitive genes formation of polypep

Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation: One of the processing steps is splicing, where portio

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

what is the skeletopy, synotopy and holotopy of the lung?

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

ATP is required for RNA-Pol to move down dsDNA, hydrolysis of ATP provides the energy to unwind the strands in front of RNAP while rewinding them behind. O True

the arctic tundra has remained frozen for thousands of years but is slowing thawing as global temperatures increase. once thawed, the environment and ecosystems

kumarravichandra kumarravichandra · Answer 1 · 2022-12-12T00:24:06-05:00

none of the answers are true. while the lagging strand has multiple origins of replication.

In contrast to the lagging strand, which is read in the replication fork's direction, the leading strand is read in the replication fork's direction in the range of 3' to 5'.Is the leading strand continually replicated?

A lagging strand duplicates intermittently, creating brief pieces, whereas a leading strand repeats continuously. This is the main distinction between the two types of strands.One new strand (the leading strand) is created during DNA replication in one continuous piece. Small fragments make up the other (lagging strand). DNA primase, DNA helicase, DNA ligase, and topoisomerase are additional enzymes necessary for DNA replication in addition to DNA polymerase.

Learn more about lagging strand here:

https://brainly.com/question/29727009

#SPJ4