the G1 checkpoint is the point in the cycle where the cell goes into or out of G0. Predict the result of a mutation that allows a cell to move past checkpoint G1 even though the cell has not grown sufficiently. the daughter cell would be small and possibly not able to store enough nutrients within the cell to survive.

Question

05-12-2022
Biology

Answered

the G1 checkpoint is the point in the cycle where the cell goes into or out of G0. Predict the result of a mutation that allows a cell to move past checkpoint G1 even though the cell has not grown sufficiently. the daughter cell would be small and possibly not able to store enough nutrients within the cell to survive.

Answer :

Other Questions

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

pick the correct match. no cell wall, only plasma membrane: no large vacuole, only small ones: no chlorophyll or chloroplasts: cell plate and no centrioles in c

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

microtubules pull the lined-up chromosomes apart :prophase metaphase anaphase telophase cytokinesis the cytoplasm divides, forming 2 identical daughter cells th

When phage nucleic acid is incorporated into the nucleic acid of its host cell and is replicated when the host DNA is replicated, this is considered part of whi

DRAW IT : The graph here shows the pH difference across the inner mitochondrial membrane over time in an active respiring cell. At the time indicated by the ver

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

g you have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove thei

luisvaschetto luisvaschetto · Answer 1 · 2022-12-07T10:23:24-05:00

The result of a mutation that allows a cell to move past checkpoint G1 even though the cell has not grown sufficiently will lead to the formation of faulty daughter cells that likely will be unable to survive in normal conditions due to the lack of nutrients and cellular products to continue with the progression of the cell lifespan.

What are the stages of the cell cycle?

The stages of the cell cycle can be divided into interphase and cell division (either miosis or meiosis cell division).

In turn, the interphase can be divided into two consecutive periods of cell growth called G1 and G2 where the cell synthesizes all material required for the cell and a final synthesis period.

Therefore, with this data, we can see that the stages of the cell cycle include G1, G2 and S phases, which are required to continue in the cell lifespan.

Learn more about the stages of the cell cycle here:

https://brainly.com/question/21087576

#SPJ1