Mutation of the muscle-specific intermediate filament desmin leads to the rare disease desmin-related myopathy. This disorder starts with weakness of the lower limbs when patients are in their 20s or 30s. As symptoms worsen, weakness in respiratory and cardiac muscles occurs, which can lead to serious problems including sudden cardiac arrest.
Which of the following mutations would disrupt desmin intermediate filament structure or function and could explain the symptoms of desmin-related myopathy? Choose all of the possible mutations.

Question

05-12-2022
Biology

Answered

Mutation of the muscle-specific intermediate filament desmin leads to the rare disease desmin-related myopathy. This disorder starts with weakness of the lower limbs when patients are in their 20s or 30s. As symptoms worsen, weakness in respiratory and cardiac muscles occurs, which can lead to serious problems including sudden cardiac arrest.
Which of the following mutations would disrupt desmin intermediate filament structure or function and could explain the symptoms of desmin-related myopathy? Choose all of the possible mutations.

Answer :

Other Questions

Compare skeletal, smooth, and cardiac muscles as to their microscopic anatomy, location and arrangement in body organs, and function in the body.

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

amar is making a cladogram. out of all the species he is using, he knows that species x and y are the least primitive and are the most closely related.where wil

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

Which of the following would be an example of a biological influence into the development of a pathological fear of the sight of blood? a. The immediate assista

syadzayasmine syadzayasmine · Answer 1 · 2022-12-07T09:43:33-05:00

mutations would disrupt desmin intermediate filament structure or function. the symptoms of desmin-related myopathy are:

(A) Mutation such that formation of dimers is blocked.

(B) Alteration in the twist or coiling of the dimers, blocking formation of staggered tetramers.

(C) Disruption of the polarity of the final desmin strands.

Desmin is an intermediate muscle-specific filament protein. Intermediate filament protein of great importance in smooth, skeletal and cardiac muscle.

Desmin-associated myopathy is a disease in which desmin is mutated. The effect of this mutation on desmin causes muscle weakness in both the lower and upper extremities, respiratory failure (breathing problems), weakness of the heart and skeletal muscles, and irregular heartbeats that can lead to heart attacks. There is a possibility.

Mutations that may lead to this desmin-associated myopathy include:

Mutation such that formation of dimers is blocked.
Alteration in the twist or coiling of the dimers, blocking formation of staggered tetramers.
Disruption of the polarity of the final desmin strands.

your question is incomplete, but most probably the full question was

Mutation of the muscle-specific intermediate filament desmin leads to the rare disease desmin-related myopathy. This disorder starts with weakness of the lower limbs when patients are in their 20s or 30s. As symptoms worsen, weakness in respiratory and cardiac muscles occurs, which can lead to serious problems including sudden cardiac arrest. Which of the following mutations would disrupt desmin intermediate filament structure or function and could explain the symptoms of desmin-related myopathy? Choose all of the possible mutations.

(A) Mutation such that formation of dimers is blocked.

(B) Alteration in the twist or coiling of the dimers, blocking formation of staggered tetramers.

(C) Disruption of the polarity of the final desmin strands.

(D) Alteration in head groups, so tetramers are unable to link end to end.

learn more about desmin-related myopathy at https://brainly.com/question/14978262

#SPJ4