sirajum378 sirajum378

29-10-2022
Biology

Answered

Select ALL of the characteristics of Cnidaria (check all that apply)
bilateral symmetry
protostome
cnidocytes
deuterostome
radial symmetry
spicules

Answer :

Other Questions

Label the following diagram to describe the overall equation of cellular respiration. Set of two molecular equations show aggregation of molecules and atoms to

Prokaryotic cells ________. (Choose all that apply.) Group of answer choices A. are very large. B. are less complex. C. have many unique organelles. D. make up

Match the term with its correct description. Group of answer choices Homeostasis [ Choose ] Hydrophillic [ Choose ] Hydrophobic [ Choose ] Passive transport [

Match it Up From your prior knowledge, match up the two types of reproduction with their characteristics and place the items in a Venn Diagram •Characteristics

Change any nucleotide between the Reading Frame (Between 'Start' and 'STOP' transcribing 5’ acgatgcattgtcccgcactgtaatat3’ 3’ tgctacgtaacagggcgtgactgcattata5’

23. The code for making proteins is carried to the ribosomes by a. tRNA b. DNA c. mRNA d. thymine

Grouper are a type of fish that often wait until they are around 20 years old to reproduce. Based on this, grouper could be considered -selected. A, r B. J C. K

Question 5 Insert any nucleotide in the Reading Frame and show the new amino acid sequence after Transcribing. 5' acgatgcattgtccagcactgacgtaatata' 3' gatacgtaa

What do there two changes have in common melting glass sanding all that apply

QUESTION 2 Upregulation and coordinated release of M protein in Streptococcus occurs in O induction O individual bacteria O biofilms O low density bacterial pop