kiaraelexapizarro kiaraelexapizarro

29-10-2022
Biology

Answered

QUESTION 2
Upregulation and coordinated release of M protein in Streptococcus occurs in
O induction
O individual bacteria
O biofilms
O low density bacterial populations

Answer :

Other Questions

Prokaryotic cells ________. (Choose all that apply.) Group of answer choices 1. are very large. 2. are less complex. 3. have many unique organelles. 4. make up

Prokaryotic cells ________. (Choose all that apply.) Group of answer choices A. are very large. B. are less complex. C. have many unique organelles. D. make up

Change any nucleotide between the Reading Frame (Between 'Start' and 'STOP' transcribing 5’ acgatgcattgtcccgcactgtaatat3’ 3’ tgctacgtaacagggcgtgactgcattata5’

Question 5 Insert any nucleotide in the Reading Frame and show the new amino acid sequence after Transcribing. 5' acgatgcattgtccagcactgacgtaatata' 3' gatacgtaa

23. The code for making proteins is carried to the ribosomes by a. tRNA b. DNA c. mRNA d. thymine

Complete the following sentence using the most appropriate words. Kylie suspects the age of the skeletal remains that she found following an excavation to be ol

Grouper are a type of fish that often wait until they are around 20 years old to reproduce. Based on this, grouper could be considered -selected. A, r B. J C. K

A scientist is studying the regrowth of giant sequoia treesafter a forest fire. The scientist plans to count the numbersof seedling trees in two different areas

Question 6 You are an ecologist researching divergent evolution on the Galapagos Islands. Which of the following might you be studying? O the processes by which

Which of the following first appeared during the Mesozoic?A. amphibiansB. birdsC. fishD. bacteria