samistamper2001 samistamper2001

28-10-2022
Biology

Answered

Change any nucleotide between the Reading Frame (Between 'Start' and 'STOP'
transcribing

5’ acgatgcattgtcccgcactgtaatat3’

3’ tgctacgtaacagggcgtgactgcattata5’

Answer :

Other Questions

Question 5 Insert any nucleotide in the Reading Frame and show the new amino acid sequence after Transcribing. 5' acgatgcattgtccagcactgacgtaatata' 3' gatacgtaa

atural Selection: Tutorial Using the data in the table, make a bar graph that shows the distribution of height for the sheep both 30 years ago and today. T Line

Read the article to learn more about the human chromosomes. Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of

Complete the following sentence using the most appropriate words. Kylie suspects the age of the skeletal remains that she found following an excavation to be ol

The image below shows Earth's layers. 0°C 21 of 30 Answered Crust 1000°C Mantle 2900 km 0.0048 Core 30 km 4300°C Rocky Plastic 5200 km Inner Liquid Core Solid I

The image below shows Earth's layers. 0°C 21 of 30 Answered Crust 1000°C Mantle 2900 km 0.0048 Core 30 km 4300°C Rocky Plastic 5200 km Inner Liquid Core Solid I

Which of the following is an exa example of a hydrolysis reaction?

Help asap.. What is a reflex arc? A. occurs when a person breathes air into his lungs B. occurs when a person is throwing a baseball to first base during a game

Question 6 You are an ecologist researching divergent evolution on the Galapagos Islands. Which of the following might you be studying? O the processes by which

Which of the following best describes the process of respiration in cells? A: only in animals B: performed only by organisms that can not perform photosynthes