imtheparent imtheparent

29-10-2022
Biology

Answered

Grouper are a type of fish that
often wait until they are around
20 years old to reproduce. Based
on this, grouper could be
considered -selected.
A, r
B. J
C. K
D. S

Answer :

Other Questions

Prokaryotic cells ________. (Choose all that apply.) Group of answer choices 1. are very large. 2. are less complex. 3. have many unique organelles. 4. make up

Prokaryotic cells ________. (Choose all that apply.) Group of answer choices A. are very large. B. are less complex. C. have many unique organelles. D. make up

Change any nucleotide between the Reading Frame (Between 'Start' and 'STOP' transcribing 5’ acgatgcattgtcccgcactgtaatat3’ 3’ tgctacgtaacagggcgtgactgcattata5’

23. The code for making proteins is carried to the ribosomes by a. tRNA b. DNA c. mRNA d. thymine

Complete the following sentence using the most appropriate words. Kylie suspects the age of the skeletal remains that she found following an excavation to be ol

Question 5 Insert any nucleotide in the Reading Frame and show the new amino acid sequence after Transcribing. 5' acgatgcattgtccagcactgacgtaatata' 3' gatacgtaa

Question 6 You are an ecologist researching divergent evolution on the Galapagos Islands. Which of the following might you be studying? O the processes by which

A scientist is studying the regrowth of giant sequoia treesafter a forest fire. The scientist plans to count the numbersof seedling trees in two different areas

In general, a patient with a severed limb has a smaller window of time for successful replantation when compared with finger replantation surgery. This is in pa

I need help with this Is this accurate, besides the opinionated parts? What else could you add to this that might be helpful on the subject of plastic waste and