yatespye yatespye

29-10-2022
Biology

Answered

23. The code for making proteins is carried to the ribosomes by

a. tRNA
b. DNA
c. mRNA
d. thymine

Answer :

Other Questions

Prokaryotic cells ________. (Choose all that apply.) Group of answer choices 1. are very large. 2. are less complex. 3. have many unique organelles. 4. make up

Prokaryotic cells ________. (Choose all that apply.) Group of answer choices A. are very large. B. are less complex. C. have many unique organelles. D. make up

Change any nucleotide between the Reading Frame (Between 'Start' and 'STOP' transcribing 5’ acgatgcattgtcccgcactgtaatat3’ 3’ tgctacgtaacagggcgtgactgcattata5’

5. In RNA Thymine (T) bonds withGuanine (G) Cytosine (C) Thymine (T) Adenine (A) Uracil (U)

Complete the following sentence using the most appropriate words. Kylie suspects the age of the skeletal remains that she found following an excavation to be ol

Read the article to learn more about the human chromosomes. Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of

Question 5 Insert any nucleotide in the Reading Frame and show the new amino acid sequence after Transcribing. 5' acgatgcattgtccagcactgacgtaatata' 3' gatacgtaa

1. Humans inherit two alleles for every gene. For an example, gene "R" provides the instructions for face shape. The dominant allele for the gene is denoted as

Question 6 You are an ecologist researching divergent evolution on the Galapagos Islands. Which of the following might you be studying? O the processes by which

Which of the following best describes the process of respiration in cells? A: only in animals B: performed only by organisms that can not perform photosynthes