To clone T, you could in principle create a (1) from (2) cells, transform it into (3) cells, and grow those cells in medium supplemented with (4). Fill in the blanks: Blank 1 can be filled with: (SELECT ALL THAT APPLY)1. Genomic DNA librarycDNA library2. antibiotic-sensitive cellsantibiotic-resistant cells3. antibiotic-resistant cellsantibiotic-sensitive cells4. tetrahydrofolate and NO antibioticantibiotic and tetrahydrofolateantibiotic and NO tetrahydrofolateNO antibiotic and NO tetrahydrofolate

Question

16-12-2022
Biology

Answered

To clone T, you could in principle create a (1) from (2) cells, transform it into (3) cells, and grow those cells in medium supplemented with (4). Fill in the blanks: Blank 1 can be filled with: (SELECT ALL THAT APPLY)1. Genomic DNA librarycDNA library2. antibiotic-sensitive cellsantibiotic-resistant cells3. antibiotic-resistant cellsantibiotic-sensitive cells4. tetrahydrofolate and NO antibioticantibiotic and tetrahydrofolateantibiotic and NO tetrahydrofolateNO antibiotic and NO tetrahydrofolate

Answer :

Other Questions

Sort the following list so that the stages of meiosis 1 appear in order. Remember You start with 1 cell and end with 2 cells

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?

Okay, I need help with this assignment, worth 50 points, which is the max amount of points you can receive here, and I am willing to mark brainiest. I need to d

In the readings, a claim is made that ice cooling is a good way to cool large buildings. Create an argument to support this claim. Give reasons and evidence fro

A human cheek cell's cycle is 24 hours. The stages within the cell cycle vary in length. G1 phase - 11 hours, G2 phase - 4 hours, S phase - 8 hours, M phase - 1

Concept Review: Calculating Doubling Time Part A Part complete Drag the values on the left to the appropriate blanks on the right to complete the sentences. Not

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

arenasaleem890 arenasaleem890 · Answer 1 · 2022-12-25T13:04:31-05:00

Antimicrobial resistance mechanisms fall into four main categories: (1) limiting uptake of a drug; (2) modifying a drug target; (3) inactivating a drug; (4) active drug efflux

Antibacterial medications are degraded by enzymes, bacterial proteins that are targets for antibiotics are changed, and membrane permeability to antibiotics is altered. These three processes constitute the three basic mechanisms of antimicrobial resistance. methicillin-resistant A. Staphylococcus (MRSA) vancomycin-resistant Enterococcus (VRE) (VRE) Drug-resistant infections are mostly brought on by the improper use and abuse of antibiotics. The proliferation of bacteria, some of which may be resistant to antibiotic therapy, is encouraged by a lack of clean water, proper sanitation, and effective infection prevention and control. Penicillins, fluoroquinolones, cephalosporins, macrolides, beta-lactams with increased activity (like amoxicillin-clavulanate), tetracyclines, trimethoprim-sulfamethoxazole, lincosamides (like clindamycin), urinary anti-infectives, and other antibiotics are all classified as one of these classes in this portal.

To learn more about click the link below:

brainly.com/question/13052094

#SPJ4