ne characteristic that distinguishes a population in an extinction vortex from most other populations is that . its genetic diversity is very low its members are rare, top-level predators it is not well adapted to edge conditions its effective population size is lower than its total population size

Question

16-12-2022
Biology

Answered

ne characteristic that distinguishes a population in an extinction vortex from most other populations is that . its genetic diversity is very low its members are rare, top-level predators it is not well adapted to edge conditions its effective population size is lower than its total population size

Answer :

Other Questions

the age pyramid below shows the age structure or a mystery population or animal. this animal reaches sexual maturity very early in life, and this population's s

a botanist studied a population of grasses in an area of erratic rainfall. she found that plants with curled leaves reproduced better in dry years, and those wi

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

What is the functional significance of the fact that the da and ne transporter proteins are not selective for their respective neurotransmitters?

these images illustrate a(n) a. monohybrid cross. b. complete dominance of body size alleles. c. incomplete dominance of body size alleles. d. dihybrid cross.

Of the following events that occur during meiosis, which contributes most to genetic diversity in the human population? Select one: a. Alignment of sister chrom

significance da and ne transporter proteins are not selective for their respective neurotransmitters. t/f

after completing the animation, briefly report your findings. list each organelle, where you found it in the cell, and what its primary function is. write your

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

arenasaleem890 arenasaleem890 · Answer 1 · 2022-12-21T01:27:52-05:00

The correct answer is Abiotic factors are non-living components of an ecosystem that influence their surroundings. Examples may be light, water, and temperature in a terrestrial habitat. Abiotic elements in a marine environment would include salinity and ocean currents.

Small populations only experience a downward cycle of population reduction. What major cause is responsible for the extinction vortex? the decline in genetic variety needed to provide reactions to environmental change through evolution, such as new strains of diseases. The phrase "extinction vortex," first used by Gilpin & Soulé in 1986, refers to the process that decreasing populations go through when "a mutual reinforcement of biotic and abiotic processes develops that pushes population size downward to extinction" (Brook, Sodhi & Bradshaw 2008). These occurrences may involve a sharp decline in population numbers brought by by illness, catastrophes, or climate change. A vortex of extinction can also be started by habitat loss or degradation. Other variables include slower-moving occurrences like excessive predation or overharvesting (from fishing, hunting, etc.).

To learn more about Abiotic click the link below:

brainly.com/question/29773665

#SPJ4