the hierarchy of animal (or plant) taxa, from the most general characteristics to the most specific, is:

Question

16-12-2022
Biology

Answered

the hierarchy of animal (or plant) taxa, from the most general characteristics to the most specific, is:

Answer :

Other Questions

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

in biology, the relationship between form and function is critical. briefly explain how this is apparent at the level of the cell. your answer should include a

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

routine monitoring of water in a reservoir has found a high count of e. coli. of the following, you would be most concerned that the contaminated water might al

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

what is the skeletopy, synotopy and holotopy of the lung?

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

the age pyramid below shows the age structure or a mystery population or animal. this animal reaches sexual maturity very early in life, and this population's s

rehan01baig rehan01baig · Answer 1 · 2022-12-20T06:00:51-05:00

The levels of classification, from broadest to most specific, include: kingdom, phylum, class, order, family, genus, and species.

The a lot of classification levels Associate in Nursing organism shares with another, the a lot of characteristics they need in common.

Kingdom

whereas scientists presently disagree on what numberkingdoms there area unit, several support a 5 kingdom (Plants, Animals, Fungi, Protists, Monerans) system.Organisms area unit placed into kingdoms supported their ability to create food and therefore the range of cells in their body.

Phylum (pl. phyla) the primary major division for every kingdom within the kingdom Plantae, phyla area unit typicallyobserved as divisions.

● Plants area unit unremarkably divided into 2 groups: tube and nonvascular.

● within the Animalia, there area unit thirty five completely different phyla. These phyla will be divided into 2 groups: vertebrates and invertebrates.

Class, Order, Family

● These levels become even a lot of specific and can embrace fewer organisms that have a lot of in common with one another as they move down the amount.

Genus (pl. Genera)

● Contains closely connected organisms.

● The genus is employed because the initial word in Associate in Nursing organism’s scientific name.

Species Consists of all the organisms of constant kind that area unitready to breed and turn out young of constant kind.

● The species is employed because the second word in Associate in Nursing organism’s scientific name.

Scientific name

● The scientific name of Associate in Nursing organism is formed from its genus and species.

● it's written in italics (Genus species) with the genus capitalized.

● for instance, gray wolf is that the scientific name for the wolf and pine tree is that the scientific name for a frankincense pine

To learn more about Taxonomy -

https://brainly.in/question/13602697

#SPJ4