reginalove5115 reginalove5115

16-12-2022
Biology

Answered

the products of mitosis are 1. one nucleus containing twice as much dna as the parent nucleus. 2. two genetically identical cells. 3. four nuclei containing half as much dna as the parent nucleus 4. four genetically identical nuclei. 5. two genetically identical nuclei

Answer :

kumarravichandra kumarravichandra

20-12-2022

the products of mitosis are

Two genetically identical nuclei cells.

A kind of cell division known as mitosis occurs when a single cell (the mother) divides into two genetically identical daughter cells. Mitosis, when referring to the cell cycle, is the stage of cell division during which the DNA in the cell's nucleus is divided into two identical sets of chromosomes.What is a brief explanation of mitosis?

(my-TOH-sis) a single parent cell's process of dividing into two new daughter cells. A full set of chromosomes from the parent cell are transferred to each daughter cell. What are mitosis' four stages?

Prophase, prometaphase, metaphase, anaphase, and telophase are these stages.

Learn more about mitosis here:

https://brainly.com/question/29776367

#SPJ4

Answer Link

Other Questions

3. The table below shows factors that could be present in a population. Next to each factor, write whether this would cause natural selection or not. (5 points

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

LIMITED TIME! PLEASE! Rhinoceroses and horses are related. They have very similar digestive systems and an odd number of toes on their feet. Horses have one toe

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

Which of the following substances are produced by the body cells to protect uninfected cells from viral invasion ? a. histamineb. complementc. natural killer ce

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Which of the following is NOT one of Mendel's hypotheses to explain the results of his P, F1 and F2 crosses? a. Adult plants carry a pair of genes that will det

based on the data from the graoh which of the folooiwng indicates how much more effective oxygen trasnport isat 30% carbon monoxide

The cells most involved with allergic reactions are A. eosinophils, mast cells, and basophils. B. neutrophils, eosinophils, and mast cells. C. monocytes, eosino