4.3.10. Network Address Translation (NAT). Which one of the following operations is NOT performed by NAT.? Select one: a. On an incoming datagram from the public Internet side of a NAT, changing the destination IP address of a datagram to a new destination IP address that is looked up in the NAT table, and (possibly after other actions), sending that IP datagram on to the LAN side of the NAT. Ob. On an outgoing datagram, changing the source IP address of a datagram received from the LAN side of the NAT O c Generating ACKs back to the TCP sender and then taking responsibility for reliably delivery the segment to its destination, possibly using a non-TCP reliable data transfer protocol. O d. On an outgoing datagram, changing the transport-layer port number of the transport-layer segment inside a datagram received from the LAN side of the NAT.

Question

15-12-2022
Biology

Answered

4.3.10. Network Address Translation (NAT). Which one of the following operations is NOT performed by NAT.? Select one: a. On an incoming datagram from the public Internet side of a NAT, changing the destination IP address of a datagram to a new destination IP address that is looked up in the NAT table, and (possibly after other actions), sending that IP datagram on to the LAN side of the NAT. Ob. On an outgoing datagram, changing the source IP address of a datagram received from the LAN side of the NAT O c Generating ACKs back to the TCP sender and then taking responsibility for reliably delivery the segment to its destination, possibly using a non-TCP reliable data transfer protocol. O d. On an outgoing datagram, changing the transport-layer port number of the transport-layer segment inside a datagram received from the LAN side of the NAT.

Answer :

Other Questions

Cold sores on the skin of the mouth occur when herpes simplex viruses that are dormant in neural ganglia become active and travel to the skin of the mouth. Whic

Which of the following would be an example of a biological influence into the development of a pathological fear of the sight of blood? a. The immediate assista

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

An S wave is a type of seismic wave called a transverse wave . Transverse waves occur when the material that carries the waves moves up and down or side to sid

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

what is the skeletopy, synotopy and holotopy of the lung?

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

amar is making a cladogram. out of all the species he is using, he knows that species x and y are the least primitive and are the most closely related.where wil

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

shomerajeshwari90 shomerajeshwari90 · Answer 1 · 2022-12-20T00:12:08-05:00

a. On an incoming datagram from the public Internet side of a NAT, changing the destination IP address of a datagram to a new destination sending that IP datagram on to the LAN side of the NAT.

NAT or network address translation is a network protocol is used by private networks to access the internet by assigning or mapping a public IP address to the private addresses.

The host with IP address 10.0.1.19 searches for the actual destination IP address 128.119.160.183 in its private network and when it does not find it, it sends the packet to the default gateway IP address 10.0.1.25, which is where the private IP address is NATted and sent to the destination.

learn more about of NAT here

https://brainly.com/question/19204809

#SPJ4