manman1522 manman1522

24-12-2022
Biology

Answered

An S wave is a type of seismic wave called a transverse wave . Transverse waves occur when the material that carries
the waves moves up and down or side to side. Aside from a seismic wave, what is an example of a transverse wave that
you have observed?

An S wave is a type of seismic wave called a transverse wave Transverse waves occur when the material that carries the waves moves up and down or side to side class=

Answer :

Other Questions

Which of the following would be an example of a biological influence into the development of a pathological fear of the sight of blood? a. The immediate assista

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

which of the following foods are good sources of preformed or active vitamin a? (select all that apply.) a. carrots b. sweet potatoes c. leafy greens d. milk e.

define and give 2 examples of each type of species relationship: define example example competition predation mutualism parasitism commensalism

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Cold sores on the skin of the mouth occur when herpes simplex viruses that are dormant in neural ganglia become active and travel to the skin of the mouth. Whic

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

which of the following statements regarding natural selection is false? natural selection depends on the local environment at the current time. natural selectio

Give the % yield if 1.78 g of O₂ is produced %Yield = Actual Yield/ Theoretical Yield x 100% %Yield = _________x 100%. = ____?______ %