In bacteria and archaea, what does the CRISPR-Cas system do? Looking at the genomes of bacteria and archaea that have been sequenced, how often is this system found?
Some bacteria have a similar, built-in, gene editing system to the CRISPR-Cas9 system that they use to respond to invading pathogens like viruses, much like an immune system. Using CRISPR the bacteria snip out parts of the virus DNA and keep a bit of it behind to help them recognize and defend against the virus next time it attacks. Scientists adapted this system so that it could be used in other cells from animals, including mice and humans. Found in ~40% sequenced bacterial genomes, ~90% sequenced archae genomes.

Question

12-12-2022
Biology

Answered

In bacteria and archaea, what does the CRISPR-Cas system do? Looking at the genomes of bacteria and archaea that have been sequenced, how often is this system found?
Some bacteria have a similar, built-in, gene editing system to the CRISPR-Cas9 system that they use to respond to invading pathogens like viruses, much like an immune system. Using CRISPR the bacteria snip out parts of the virus DNA and keep a bit of it behind to help them recognize and defend against the virus next time it attacks. Scientists adapted this system so that it could be used in other cells from animals, including mice and humans. Found in ~40% sequenced bacterial genomes, ~90% sequenced archae genomes.

Answer :

Other Questions

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

How is gas exchange regulated at the organ system level?

choose the term that describes a bacteriophage infection in which the host bacteria are lysed and killed by the infection

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Which term names what can regulate gene expression in eukaryotesGene expression can occur at several points along the pathway from DNA to RNA to proteins. In on

The recommendation were to "Consume less than 10% of calories from saturated fatty acids and less than 300 mg/d of cholesterol, and keep trans fatty acid consum

Based on this kind of biogeographical evidence, a scientist might propose the following hypothesis: The common ancestor of the cactus family evolved in the area

12. The diagram represents the digestive system of a student who has eaten a sandwich consisting of two slices of bread, chicken, lettuce, and mayonnaise. The

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

contexto065 contexto065 · Answer 1 · 2022-12-18T02:28:45-05:00

Some bacteria and archaea have a built-in gene editing system that is comparable to the CRISPR-Cas system, which they employ to respond to pathogens like viruses that are infecting them in a manner akin to an immune system.

The bacteria and archaea use CRISPR to cut off portions of the virus DNA and retain a little portion of it so they can identify and defend against the virus the next time it assaults. This technique was modified by scientists so that it could be applied to different animal cells, such as those from mice and people. Found in 90% of sequenced archae genomes and about 40% of sequenced bacterial genomes.

Know more about the CRISPR-Cas at: https://brainly.com/question/15828780

#SPJ4