The length of time it takes for the cells labeled during DNA synthesis to begin to enter mitosis is a good estimate of the length of the _______ phase(s).
a. G1
b. S
c. G2
d. M
Answer: C

Question

12-12-2022
Biology

Answered

The length of time it takes for the cells labeled during DNA synthesis to begin to enter mitosis is a good estimate of the length of the _______ phase(s).
a. G1
b. S
c. G2
d. M
Answer: C

Answer :

Other Questions

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

which of the following foods are good sources of preformed or active vitamin a? (select all that apply.) a. carrots b. sweet potatoes c. leafy greens d. milk e.

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

Fossilized life forms which, according to Darwin, show a transition between one species and another are called... answer choices Distinct layers of rock Index f

contexto1005 contexto1005 · Answer 1 · 2022-12-18T02:15:08-05:00

The length of time it takes for the cells labeled during DNA synthesis to begin to enter mitosis is a good estimate of the length of the (c) G2 phase.

The length of time it takes for the cells labeled during DNA synthesis to begin to enter mitosis is a good estimate of the length of the G2 phase. This is the second phase of the cell cycle, and it follows G1 (growth) and precedes M (mitosis) and Sc (synthesis).

The G2 phase is where cells prepare for mitosis, the process in which the cell splits into two daughter cells. During this phase, the cell performs several important tasks, such as replicating DNA, synthesizing proteins, and organizing microtubules. The length of the G2 phase can vary depending on the type of cell and its growth environment.

To determine how long it takes for cells labeled during DNA synthesis to enter mitosis, scientists measure the length of the G2 phase by monitoring the cell cycle as it progresses from G1 to M and Sc. For example, researchers may measure the time it takes for cells to increase in size and for their nuclei to replicate. They can also observe the cell's microtubules as they prepare for mitosis.

Learn more about DNA at :https://brainly.com/question/13833034

#SPJ4

The length of time it takes for the cells labeled during DNA synthesis to begin to enter mitosis is a good estimate of the length of the _______ phase(s). a. G1 b. S c. G2 d. M Answer: C

Answer :

Other Questions

The length of time it takes for the cells labeled during DNA synthesis to begin to enter mitosis is a good estimate of the length of the _______ phase(s).
a. G1
b. S
c. G2
d. M
Answer: C