A Sickle Cell Anemia Detection Simulation: PCR, Restriction Enzyme Digest, and Electrophoresis In this activity, the genotyping of a newborn baby will be simulated with respect to the sickle cell mutation. Does the baby have a wild-type beta-globin gene, a mutation on one allele (carrier), or a mutation on both alleles (homozygous)? Known samples of wild-type and homozygous mutant beta globin will be used for comparison. 1. Write down the known partial DNA sequence for the wild-type beta-globin gene as seen below. This sequence represents the portion of the beta-globin gene that has been amplified using PCR. Typically, amplified sequences will be longer than this example. and some restriction enzymes need longer sequences to function. However, for ease in this activity, the sequences are short. Wild-type: 5' CTG ACT CCT GAG 3: 3' GAC TGA GGA CTC 5' 2. Beside the wild-type sequence, write the DNA sequence for the known mutation associated with sickle cell anemia. Tanio 2 Homorygous mutant: 5' CTG ACT CCT GTG
3 ′3' GAC TGA GGA CAC 5' 3. Determine the recognition site and cleavage pattern of Dde 1 by referring to the restriction enzyme table provided in the background section (see Table 1). Remember that the

Question

09-12-2022
Biology

Answered

A Sickle Cell Anemia Detection Simulation: PCR, Restriction Enzyme Digest, and Electrophoresis In this activity, the genotyping of a newborn baby will be simulated with respect to the sickle cell mutation. Does the baby have a wild-type beta-globin gene, a mutation on one allele (carrier), or a mutation on both alleles (homozygous)? Known samples of wild-type and homozygous mutant beta globin will be used for comparison. 1. Write down the known partial DNA sequence for the wild-type beta-globin gene as seen below. This sequence represents the portion of the beta-globin gene that has been amplified using PCR. Typically, amplified sequences will be longer than this example. and some restriction enzymes need longer sequences to function. However, for ease in this activity, the sequences are short. Wild-type: 5' CTG ACT CCT GAG 3: 3' GAC TGA GGA CTC 5' 2. Beside the wild-type sequence, write the DNA sequence for the known mutation associated with sickle cell anemia. Tanio 2 Homorygous mutant: 5' CTG ACT CCT GTG
3 ′3' GAC TGA GGA CAC 5' 3. Determine the recognition site and cleavage pattern of Dde 1 by referring to the restriction enzyme table provided in the background section (see Table 1). Remember that the

Answer :

Other Questions

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Under optimal conditions the number of DNA molecules amplified from a single molecule in a PCR after 30 amplification cycles will be A) 30 B) 30 x 2 C) 30^2 D)

in biology, the relationship between form and function is critical. briefly explain how this is apparent at the level of the cell. your answer should include a

the coat colour in mice is controlled by several genes. the aqout patter characterised by yellow band of pigment near the tip of the hairs is produced by the do

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Refer to the equation below to answer this question. What are the REACTANTS of this chemical reaction??

Sort the following list so that the stages of meiosis 1 appear in order. Remember You start with 1 cell and end with 2 cells

AnnuG AnnuG · Answer 1 · 2022-12-14T14:14:42-05:00

The individual will suffer from sickle cell anemia, when both beta-globin gene has mutation. DNA sequence for the wild-type beta-globin gene is 3' GAC TGA GGA CTC 5' . In mutation codon CTC changes into CAC in mutant gene.

The normal individual gene coding for the beta-globin gene 5' CTG ACT CCT GAG 3 and 3' GAC TGA GGA CTC 5'. The mutation changes DNA sequence into ′3' GAC TGA GGA CAC 5'. The recognition sites of the Dde1 enzyme is CTGAG on both strand. The cleaving site for this enzyme will be TGAG on 5' CTG ACT CCT GAG 3 and GACT on 3' GAC TGA GGA CTC 5' strand.

A mutant form of hemoglobin, known as hemoglobin S, is the root cause of the hereditary condition known as sickle-cell anemia (HbS). The main cause of sickle cell disease (SCD), which results in severe morbidity and mortality, is the substitution of valine for glutamic acid in hemoglobin molecules.

Hence, sickle cell anemia is caused due to single amino acid changes in beta globin chain.

To know more about Hemoglobin.

https://brainly.com/question/517799

#SPJ4