A mutation in GLUT4 changes the Kt value from 5mM (wild type) to 3mM (mutant). The velocity of glucose entry into a mutant cell would be higher than a cell expressing the wild type version of a blood glucose concentration of 5mM.
True

Question

09-12-2022
Biology

Answered

A mutation in GLUT4 changes the Kt value from 5mM (wild type) to 3mM (mutant). The velocity of glucose entry into a mutant cell would be higher than a cell expressing the wild type version of a blood glucose concentration of 5mM.
True

Answer :

Other Questions

g you have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove thei

g ou have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove their

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

Which of the following predicts what would happen if glucose moved by facilitated diffusion instead?

Which of the following would be an example of a biological influence into the development of a pathological fear of the sight of blood? a. The immediate assista

pick the correct match. no cell wall, only plasma membrane: no large vacuole, only small ones: no chlorophyll or chloroplasts: cell plate and no centrioles in c

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

contexto1026 contexto1026 · Answer 1 · 2022-12-15T14:50:03-05:00

It is true to say that a GLUT4 mutation reduces the Kt value from 5mM (wild type) to 3mM. (mutant). The rate of glucose entry into a mutant cell at a blood glucose concentration of 5 mM would be faster than into a cell expressing the wild type form.

A gene on chromosome 17 codes for GLUT 4, a protein that transports genetically encoded glucose and is found in adipocytes, skeletal muscle, and cardiac muscle. It has a 5 mm Km for glucose. The majority of GLUT 4 is stored in intracellular vesicles when there is not a sufficient stimulation.

We created transgenic mice that produce large quantities of the GLUT4/muscle-fat specific facilitative glucose transporter in a tissue-specific way to better understand the physiological function of this protein in controlling glucose homeostasis. Examining two different founder lines revealed that high-level GLUT4 protein expression markedly decreased fasting glucose levels in comparison to wild-type mice (around 130 mg/dl) by about 70 mg/dl.

To learn more about glucose visit : brainly.com/question/7224754

#SPJ4

Correct Question:

A mutation in GLUT4 changes the Kt value from 5mM (wild type) to 3mM (mutant). The velocity of glucose entry into a mutant cell would be higher than a cell expressing the wild type version of a blood glucose concentration of 5mM. State True or False

A mutation in GLUT4 changes the Kt value from 5mM (wild type) to 3mM (mutant). The velocity of glucose entry into a mutant cell would be higher than a cell expressing the wild type version of a blood glucose concentration of 5mM. True

Answer :

Other Questions

A mutation in GLUT4 changes the Kt value from 5mM (wild type) to 3mM (mutant). The velocity of glucose entry into a mutant cell would be higher than a cell expressing the wild type version of a blood glucose concentration of 5mM.
True