what is the founder effect; what is genetic drift; bottleneck effect; genetic drift vs gene flow; what causes genetic drift; population bottleneck; genetic drift example; genetic bottleneck

Question

06-12-2022
Biology

Answered

what is the founder effect; what is genetic drift; bottleneck effect; genetic drift vs gene flow; what causes genetic drift; population bottleneck; genetic drift example; genetic bottleneck

Answer :

Other Questions

What is the greatest threat humans pose to biodiversity? interspeciation habitat loss genetic mutations invasive species

The diagram above depicts a karyotype of an individual human. Which of the following statements concerning the karyotype in the diagram is true? Select all that

3. The table below shows factors that could be present in a population. Next to each factor, write whether this would cause natural selection or not. (5 points

Based on this kind of biogeographical evidence, a scientist might propose the following hypothesis: The common ancestor of the cactus family evolved in the area

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

what is the most realistic cause of the population crashes for the lynx every few years?

Which sentence best describes the origin of the kinetic energy used to make ATP from ADP and phosphate groups? A. ADP molecules flow through ATP synthase and co

With the concept of CHANGING- ENVIRONMENT HYPOTHESIS in mind, what could be the possible explanation why the frequency of meiosis in protists increases when the

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Giving brainiest for whoever answers this correctly. You are doing a pepper experiment 1. What do you want to learn in your experiment? 2. You want to study the

contexto1212 contexto1212 · Answer 1 · 2022-12-09T03:13:30-05:00

Alleles alter frequency within a population owing to random sampling in genetic drift. As a result, no modifications are produced.

The transmission of alleles or gametes from one group to another distinguishes gene flow from genetic drift. When a population migrates or becomes geographically isolated, this occurs.

When a population is drastically reduced in number due to a natural disaster (bottleneck effect), or when a small group breaks off from the main population to establish a colony, genetic drift can have serious consequences (founder effect).

The sort of event that produces founder events and population bottlenecks is what distinguishes them.

A founder event happens when a small number of people is isolated from the rest of the population, but a bottleneck effect happens when the majority of the population is annihilated.

For small populations, genetic drift can result in significant genetic variety loss. A population bottleneck occurs when the size of a population is decreased for at least one generation.

Learn more about to bottleneck visit here;

https://brainly.com/question/13302820

#SPJ4