Order the species pairs from fewest single nucleotide differences (1) to most single nucleotide differences (4).
Rank the options below.
chimpanzee and gorilla
tiger and frog
human and mouse
finch and earthworm

Question

06-12-2022
Biology

Answered

Order the species pairs from fewest single nucleotide differences (1) to most single nucleotide differences (4).
Rank the options below.
chimpanzee and gorilla
tiger and frog
human and mouse
finch and earthworm

Answer :

Other Questions

g you have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove thei

g ou have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove their

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Give the % yield if 1.78 g of O₂ is produced %Yield = Actual Yield/ Theoretical Yield x 100% %Yield = _________x 100%. = ____?______ %

Which of the following would be an example of a biological influence into the development of a pathological fear of the sight of blood? a. The immediate assista

Both Aristotle and Linnaeus classified all living things as plants or animals. Today, scientists use a classification system that involves three domains, six ki

amar is making a cladogram. out of all the species he is using, he knows that species x and y are the least primitive and are the most closely related.where wil

which of the following foods are good sources of preformed or active vitamin a? (select all that apply.) a. carrots b. sweet potatoes c. leafy greens d. milk e.

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

Vygotsky theory emphasizes which of the following factors in a child's development? - social interactions in cultural contexts - individual differences in traje

jaspreetsharma jaspreetsharma · Answer 1 · 2022-12-09T03:44:35-05:00

Gorillas and chimps,Mouse and human,Frog with a tiger,earthworm and finch

The Sequence Viewer suitable methods may be used to look for reference SNPs from the NCBI SNP database for human sequences, such as rs4970989. If the SNP is located in the assembly or molecule, the view shifts to be near the SNP, and a marking is placed automatically. The genomes of the chicken & duck should differ the least from one another. Humans and chimpanzees share nearly all of the same genes. The OPN1LW gene, that enables both animals to see the color red, is present in both. The Indian muntjac is the mammal species with the fewest chromosomes known to exist, with just 6 in females and 7 in males (the extra chromosome being the Y chromosome).

Learn more about human

https://brainly.com/question/276208

#SPJ4

Order the species pairs from fewest single nucleotide differences (1) to most single nucleotide differences (4). Rank the options below. chimpanzee and gorilla tiger and frog human and mouse finch and earthworm

Answer :

Other Questions

Order the species pairs from fewest single nucleotide differences (1) to most single nucleotide differences (4).
Rank the options below.
chimpanzee and gorilla
tiger and frog
human and mouse
finch and earthworm