leilei1080 leilei1080

06-12-2022
Biology

Answered

In the water cycle, evaporated equatorial air masses that rise lose most of their water. The air immediately then flows

Answer :

RupaBera RupaBera

10-12-2022

A ring of deserts is then instantly formed by the air quickly flowing 30° north or south.

What causes the winds to blow across the surface of the earth?

Wind is caused by the uneven heating of the Earth's surface, which creates pressure variations throughout the atmosphere and causes air parcels to move from locations of greater pressure to those of lower pressure.

A "n" is used to describe an ocean current that provides abundant nutrients to the surface.?

Deep, icy water rises to the surface during an upwelling process. This diagram demonstrates how nutrient-rich, cold water that "wells up" from below replaces displaced surface waters.

To know more about water cycle visit:-

https://brainly.com/question/1151425

#SPJ4

Answer Link

Other Questions

routine monitoring of water in a reservoir has found a high count of e. coli. of the following, you would be most concerned that the contaminated water might al

the morris water maze is a task in which a rat must swim through murky water to find a platform. a rat with hippocampal damage has difficulty with the morris wa

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

chimpanzees have a relatively low birth rate. they take good care of their young, and most chimps live a long life well into their post-reproductive years. the

is the liquid portion of blood in which blood cells are suspended. contains albumin and globulins. is mostly water. contains fibrinogen. all of these choices ar

amar is making a cladogram. out of all the species he is using, he knows that species x and y are the least primitive and are the most closely related.where wil

True/False mineral nutrients are cycled through ecosystems and their environment. water, carbon, nitrogen, phosphorus and sulfur are of particular importance. h

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

What is the functional significance of the fact that the da and ne transporter proteins are not selective for their respective neurotransmitters?