which of the following features of archaeal gene expression differentiate them from bacteria?

Question

05-12-2022
Biology

Answered

which of the following features of archaeal gene expression differentiate them from bacteria?

Answer :

Other Questions

Which term names what can regulate gene expression in eukaryotesGene expression can occur at several points along the pathway from DNA to RNA to proteins. In on

Select the correct answer. A gene with the sequence ATTCATTCA underwent duplication after a few generations. Which sequence represents this gene after the mutat

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

choose the term that describes a bacteriophage infection in which the host bacteria are lysed and killed by the infection

the enterotoxin of the bacterium clostridium perfringens upregulates the expression of human claudins, including cldn6. given the information in the passage, ho

2. Compare the value for ionization energy for the following pairs of elements. Justify your answer. a. Li and B b. Mg and Ca 3. Which of the following has the

Eye Color is controlled via a polygenic interaction between two genes. They will be represented by gene “a” and gene “b”. The chart below shows how the genes in

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?

The recommendation were to "Consume less than 10% of calories from saturated fatty acids and less than 300 mg/d of cholesterol, and keep trans fatty acid consum

tutorconsortium642 tutorconsortium642 · Answer 1 · 2022-12-11T07:12:16-05:00

The following characteristics of archaeal specific genes set them apart from bacteria genetically: By contract, bacteria include base pairs in their tRNA but archaeans do not.

What carry out bacteria?

Some bacteria aid in the digestion of food, assist the body produce necessary vitamins, and eliminate disease-causing cells. Additionally, bacteria are employed to create nutritious foods like cheddar cheese and yogurt. Though, influenza staph infections you to become ill. Within your body, they multiply rapidly.

Who are bacteria and what causes them?

An intricate single cell encompasses a pathogens has the capacity to endure either within and outside the body on its own. Most germs don't cause harm. In truth, our bodies contain a variety of bacteria, particularly in the stomach where they aid in digestion. Some germs, however, can lead to illnesses.

To know more about bacteria visit :

https://brainly.com/question/8008968

#SPJ4