A third-order neuron ______.is an interneuronis the shortest neuron in either a sensory or a motor pathwayis the third neuron in a motor pathway

Question

05-12-2022
Biology

Answered

A third-order neuron ______.is an interneuronis the shortest neuron in either a sensory or a motor pathwayis the third neuron in a motor pathway

Answer :

Other Questions

Which term names what can regulate gene expression in eukaryotesGene expression can occur at several points along the pathway from DNA to RNA to proteins. In on

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

in order to provide the omega-3 fatty acids dha and epa to the developing fetus, it is recommended that pregnant women eat 8-12 ounces of per week. openoregon

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

Do you think that the tryptophan in turkey is primarily responsible for making you sleepy after your Thanksgiving meals? Why or why not? (Does not necessarily n

Type the correct answer in each box

Alligators are predators that live in the Florida Everglades. A scientist is using a computer model to determine whether the alligator is a keystone species in

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Paruljain Paruljain · Answer 1 · 2022-12-08T01:50:04-05:00

A third-order neuron is an interneurons the shortest neuron in either a sensory or a motor pathway is excites or inhibits the pathway.

A neuron, or nerve cell is an electrically excitable cell that communicates with other cells via specialized connections called synapses. In all species, the neuron is the main component of nervous tissue, with the exception of sponges and placozoa. Non-animals such as fungi and plants are instances of organisms without nerve cells. The roles of three different types of neurons can generally be identified. Sense neurons, which impact the cells of the sensory organs, send signals to the spinal cord or brain in response to stimuli like touch, sound, or light. Motor neurons get guidance from the brain and spinal cord to regulate anything from glandular secretion to muscle contractions. Interneurons exist in the same area of the brain or spinal cord. An axon, dendrites, and cell body comprise a typical neuron (soma). The soma, which is a compact structure, is the source of the axon and dendrites. Dendrites typically extend hundreds of micrometers from the soma and branch out widely.

To know more about neuron please refer: https://brainly.com/question/29462317

#SPJ4