hipstersale9695 hipstersale9695

05-12-2022
Biology

Answered

Match structures in the left column with their descriptions in the right column.1. anus A. accessory digestive organ that produces bile2. appendix (vermiform) B. accessory digestive organ that produces insulin3. cecum C. blind pouch attached to the cecum4. colon D. connects the mouth and stomach5. duodenum E. first part of the small intestine6. esophagus F. first part of the large intestine7. gallbladder G. last part of the large intestine8. ileum H. major portion of the large intestine9. jejunum I. one of three pairs that secrete digestive juices into the mouth10. liver J. outlet of the large intestine11. pancreas K. portion of small intestine that joins the large intestine12. rectum L. second location of chemical digestion13. salivary gland M. second part of small intestine14. stomach N. storage sac for bile

Answer :

rathipushpendra345 rathipushpendra345

08-12-2022

1. anus - J. large intestinal outflow

2. appendix (vermiform) - C. The blind pouch connected to the cecum,

3. Cecum- F. the first big intestine segment

4. colon- H. the big intestine's main section

5. Duodenum- E. the small intestine's initial section

6. esophagus- D. links the stomach and mouth.

7. gallbladder- storage sac in the bile

8. ileum-K. the segment of the small intestine that connects to the large intestine

9. jejunum -M. second small intestine segment

10. liver- A. bile-producing auxiliary digestive organ

11. pancreas- auxiliary digestive organ that makes insulin

12. Rectum- G. the big intestine's last segment

13. salivary gland- I. one of the three pairs whose mouth-borne digestive fluids are secreted.

The human body's digestive system consists of a collection of organs that operate in concert to transform food into energy. The gastrointestinal tract, along with auxiliary organs including the liver, pancreas, and gallbladder, make up the digestive system anatomically. The mouth, stomach, esophagus, small intestine, and large intestine, which houses the rectum and anus, are among the hollow organs that make up the gastrointestinal tract (GI tract).

The right answers are 1—J, 2—C, 3—F, 4—H, 5—E, 6—D, 7—N, 8—K, 9—M, 10—A, 11—B, 12—G, 13—I, and 14—L.

To learn more about liver, refer:-

https://brainly.com/question/15637828

#SPJ4

Answer Link

Other Questions

Concept Review: Calculating Doubling Time Part A Part complete Drag the values on the left to the appropriate blanks on the right to complete the sentences. Not

all organisms face trade-offs that arise from the constraints that they face. one example of a constraint: energy spent on one task cannot be spent on another.

pick the correct match. no cell wall, only plasma membrane: no large vacuole, only small ones: no chlorophyll or chloroplasts: cell plate and no centrioles in c

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

old-growth forests can be described by which of the following group of answer choices a clear forest floor free of dead wood or debris are considered good choic

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

what is the skeletopy, synotopy and holotopy of the lung?