a second-order neuron . multiple choice question. is an interneuron is the second neuron in a motor pathway is the second-longest neuron in either a sensory or a motor pathway

Question

05-12-2022
Biology

Answered

a second-order neuron . multiple choice question. is an interneuron is the second neuron in a motor pathway is the second-longest neuron in either a sensory or a motor pathway

Answer :

Other Questions

Neural mechanisms that may help explain some of the strength gains from resistance training include all except A. increased synchronization of motor unit activa

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

what is the skeletopy, synotopy and holotopy of the lung?

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

Choose statements true of transgression and regression. Sort the statements as being true of either transgression or regression.

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

in biology, the relationship between form and function is critical. briefly explain how this is apparent at the level of the cell. your answer should include a

a botanist studied a population of grasses in an area of erratic rainfall. she found that plants with curled leaves reproduced better in dry years, and those wi

blood cells could be modified to better carry oxygen, which would help the athlete's muscles to not get sore as fast. lactic acid wouldn't build up as fast eith

dipankarkundu4589 dipankarkundu4589 · Answer 1 · 2022-12-08T06:41:26-05:00

Neurons come in three different orders. Signals are sent from the peripheral to the spinal cord by first-order neurons, and they are sent from the spinal cord to the thalamus by second-order neurons.

In the centre of your brain is a structure called the thalamus that resembles an egg. It serves as a relay station for all incoming hearing, taste, sight, and touch (but not smell) sensory information from your body to your brain. All information must first pass through your thalamus, which functions as a relay or train station, before being routed or directed to the cerebral cortex, the outermost layer of your brain, for additional processing and interpretation. transmitting sensory data. obtaining data from all of your senses in the form of nerve signals. just smell enters your brain. A thalamic nucleus is responsible for processing and transmitting information from each sensory function to the corresponding region of your cerebral cortex. relaying information about movement (motor). Your thalamus is the hub of all motor pathways, just like it is for sensory information.

Learn more about thalamus here

https://brainly.com/question/6330373

#SPJ4