in operant conditioning, reinforcement stimuli induce higher activity in the nucleus accumbens due to the release of______from neurons in the mesolimbic and mesocortical systems

Question

05-12-2022
Biology

Answered

in operant conditioning, reinforcement stimuli induce higher activity in the nucleus accumbens due to the release of______from neurons in the mesolimbic and mesocortical systems

Answer :

Other Questions

Vygotsky theory emphasizes which of the following factors in a child's development? - social interactions in cultural contexts - individual differences in traje

Which of the following could be elements of cytoarchitecture, as related to Brodmann’s microscopic studies of the cerebral cortex? a. connections to the cerebel

In the readings, a claim is made that ice cooling is a good way to cool large buildings. Create an argument to support this claim. Give reasons and evidence fro

a nucleus with mass number and atomic number undergoes decay (positron emission). the mass number and atomic number, respectively, of the product nucleus are

a botanist studied a population of grasses in an area of erratic rainfall. she found that plants with curled leaves reproduced better in dry years, and those wi

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

in fruit flies red eye color (R) is dominant to white eyes (r) in a cross between two flies, 50% of the male and 50% of the female offspring had red eyes. The o

Compare skeletal, smooth, and cardiac muscles as to their microscopic anatomy, location and arrangement in body organs, and function in the body.

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

fawadmohd fawadmohd · Answer 1 · 2022-12-07T20:58:10-05:00

in operant conditioning, reinforcement stimuli induce higher activity in the nucleus accumbens due to the release of dopamine from neurons in the mesolimbic and mesocortical systems

Dopamine is sent to the nucleus accumbens and amygdala via the VTA via the mesolimbic pathway. The nucleus accumbens is a structure that may be located in the ventral medial region of the striatum and is thought to have an impact on the placebo effect, desire, and reward. An essential limbic system component that is linked to emotion is the amygdala. Diseases like addiction and depression are impacted by the mesolimbic pathway.

learn more about mesolimbic here

brainly.com/question/14950226

#SPJ4