envrionmental influences can determingwether a gene is expressed for some people that will be decisive in whether they develope a psychological disorder. this best illustrates the need for

Question

05-12-2022
Biology

Answered

envrionmental influences can determingwether a gene is expressed for some people that will be decisive in whether they develope a psychological disorder. this best illustrates the need for

Answer :

Other Questions

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

Can anyone do this for me like 10-20 minutes?

a compound that preents teh seperation of the homogous chromsoems in anaphase 1 is being studid. which fo the followign questions can be best answered during th

based on the antibiotic-resistant bacteria lab, which of the following mechanisms of change in gene frequencies is responsible for the antibiotic resistance of

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

operon operator repressor regulatory gene corepressor trp operon tryptophan lac operon allolactose inducible operon vs. repressible operon activator inducer cyc

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

a botanist studied a population of grasses in an area of erratic rainfall. she found that plants with curled leaves reproduced better in dry years, and those wi

the arctic tundra has remained frozen for thousands of years but is slowing thawing as global temperatures increase. once thawed, the environment and ecosystems

Qwclear Qwclear · Answer 1 · 2022-12-07T09:22:47-05:00

The environmental influences on gene expression best illustrates the need for research on epigenetics.

Genes have very prominent role in diseases which are affected by environmental factors. People suffer from anxiety and depression due to gene mutation, however such conditions are rare. Scientists are researching on the potential conditions which affect gene. Epigenetics is the field of scientific research which correlates the the behaviors and the environmental conditions which prominently describes the gene expression. However, epigenetic changes are reversible in nature and they do not change the DNA sequence in the body as it occurs during mutations due to radio waves which encounters the body. Epigenetic changes are modifications to DNA that regulate whether genes are turned on or off.

Learn more about epigenetics at:

brainly.com/question/11817894

#SPJ4