master59 master59

14-11-2022
Biology

Answered

Which of the
following is NOT
a focus of food
microbiology?
A. preventing food spoilage
B. using microbes in making food
C. curing diseases that can be grown in food this
D. preventing food-borne illnesses

Answer :

Other Questions

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Biology bar chart Some student collected food packaging labels to find the nutrients present in bananas Nutrients. Mass\g per 100g Carbohydrate.

Photosynthesis is a process of transformation of ENERGY. Which statement is FALSE : Sugars are the source of energy Light energy is tranformed Carbon Dioxyde (

Bonus Question: What is the height of the plant that was kept in the sun for 3 hours on day 10? 4. This line graph compares the growth of plants that were kept

Supplemental Activities (These are optional and not graded - please do not submit) 1. Research and write a paper about two famous earth scientists. 2. Research

its correct meaning. 1. criteria pollutants 2. electrostatic precipitator 3. national ambient air quality standards 4. primary standards 5. secondary standards

What is the purpose of studying radon pollution levels? A. to give scientists more information on nuclear decay B. to improve air quality and human health

Lesson 3.2 Review -- High School, Grade 9 1. How does solar energy and the greenhouse effect impact Earth's global climate system? 2. Describe the factors that

Help Please!! 50 Points Please have 3-4 Paragraphs What are 3 Different Endangered animal species in the Blue Ridge Mountains Describe the animals species rol

Which of the following is not an explanation of the relationship between nucleic acids and proteins? F G H J The sequence of nucleotides in DNA determines the o