clbmed504 clbmed504

14-11-2022
Biology

Answered

20 Points!! Fill in the blanks

Ecological succession is the observed process of change in the species structure of an ecological community over time. Within any community some species may become 1)
Abundant over time, or they may even vanish from the ecosystem altogether. Other species within the community may become _ abundant, or new species may even invade into the community from other ecosystems.

There are two types of ecological succession
- Primary ecological succession and
- ___ ecological succession
Upon what substrate does primary succession begin? (Is it soil / sediment or is it a lifeless area?)

Give 4 Examples

Answer :

Other Questions

What type of ecological succession will most likely take place after volcanic activity in an area?

HELP PLEASE! Fill in the blanks 1) __ species - affect the type and abundance of other species in an ecosystem. the ecosystem would be drastically different if

PLEASE HELP! fill in the blanks 1) __ species - one that is at serious risk of extinction 2) __ species - one that is likely to become endangered soon through a

Fill in the blanks! Functional Diversity - the variety of processes that occur within ecosystems, such as Energy flow Matter cycling and 1) _ 2) _. If an ecosys

Help Please!! 50 Points Please have 3-4 Paragraphs What are 3 Different Endangered animal species in the Blue Ridge Mountains Describe the animals species rol

Photosynthesis is a process of transformation of ENERGY. Which statement is FALSE : Sugars are the source of energy Light energy is tranformed Carbon Dioxyde (

Diverse plant communities have species representing a variety of plant types such as grasses, shrubs, succulents, hardwood trees, softwood trees, vines, ferns,

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Bonus Question: What is the height of the plant that was kept in the sun for 3 hours on day 10? 4. This line graph compares the growth of plants that were kept

Supplemental Activities (These are optional and not graded - please do not submit) 1. Research and write a paper about two famous earth scientists. 2. Research