clbmed504 clbmed504

14-11-2022
Biology

Answered

PLEASE HELP! fill in the blanks

1) species - one that is at serious risk of extinction

2) species - one that is likely to become endangered soon through all or part of its range.

3) species - these have a variety of roles (niches) in an ecosystem as they eat a wide variety of foods, live in a wide range of environments, and are therefore less prone to extinction. Examples: and

4) species. - these have specialized diets, live in only a few types of habitats and are therefore more prone to extinction, for example:

5) species - found only in one area and nowhere else in the world.

Answer :

Other Questions

Two lizard species both forage in fig trees in the Caribbean. To study potential competition between the species, you observe a sample of both species, observin

Fill in the blanks! Functional Diversity - the variety of processes that occur within ecosystems, such as Energy flow Matter cycling and 1) _ 2) _. If an ecosys

Photosynthesis is a process of transformation of ENERGY. Which statement is FALSE : Sugars are the source of energy Light energy is tranformed Carbon Dioxyde (

Supplemental Activities (These are optional and not graded - please do not submit) 1. Research and write a paper about two famous earth scientists. 2. Research

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Bonus Question: What is the height of the plant that was kept in the sun for 3 hours on day 10? 4. This line graph compares the growth of plants that were kept

its correct meaning. 1. criteria pollutants 2. electrostatic precipitator 3. national ambient air quality standards 4. primary standards 5. secondary standards

explain the importance of the following. a The trachea wall contains C-shaped rings of cartilage. b The distance between the air in an alveolus and the blood i

PLSSS HELPPP 50 POINTS!! (that's all I have :) Designing an Investigation to Test the Activity of Yeast Cells in Anaerobic Conditions: In this part of the lab,

31. Use the diagram to answer the question below. What would happen to the solar energy that reaches Earth's atmosphere if the ground was covered w (1 point) 30