justdoingmeee justdoingmeee

13-11-2022
Biology

Answered

Similar to the Galápagos finches, the Hawalian honeycreepers are a group of diverse
birds that are descended from a common ancestor. Over time, different adaptations
evolved for feeding and mating in their respective habitats. V Compare How does
common ancestry explain Loss's observations of anoles?

Answer :

Other Questions

Bonus Question: What is the height of the plant that was kept in the sun for 3 hours on day 10? 4. This line graph compares the growth of plants that were kept

WORTH 100 POINT Specialized cells are not genetically identical because they have different structures and functions. True False The center of this image show

Write a scientific explanation about how different organisms compare throughout development.

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

How does mitosis help our sequoia tree become so big? Question 5 options: Mitosis makes gametes that are genetically different in order to produce seeds for th

how are human muscle cells different from the other cells

Procedure Note: The procedures for this lab as shown in the video are very good if you need extra help. 1. Tape the black paper to the outside of the jar so tha

5. Draw a model that shows the organization of the human digestive system. Your model should include labels for and information about cells, tissues, organs, an

explain the importance of the following. a The trachea wall contains C-shaped rings of cartilage. b The distance between the air in an alveolus and the blood i

A cell is the smallest unit of biological organization that has all of the characteristics of life. Which of the following are considered characteristics of lif