For the purposes of this question, assume that a g1 somatic cell nucleus in a female myrmecia pilosula contains 2 picograms of dna. How much dna would be expected in a metaphase i cell of a female?.

Question

08-11-2022
Biology

Answered

For the purposes of this question, assume that a g1 somatic cell nucleus in a female myrmecia pilosula contains 2 picograms of dna. How much dna would be expected in a metaphase i cell of a female?.

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

similar between skin cell and fat cell

. using the pictures below, identify the phases of the cell cycle using the words: interphase, prophase, metaphase, anaphase, telophase and cytokinesis

Apoptosis ____. a. Only occurs if DNA is damaged beyond repair b. Occurs as telomeres increase in length c. In a normal repair process in multicellular organism

Which of the following correctly compares the structures of plant and animal cells? Both plant and animal cells have endoplasmic reticulum, where cellular respi

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

one female contraceptive vaccine that is currently being researched is intended to immunize women against the hcg, which is necessary to maintain the implantati

A somatic mutation is: a. heritable b. always harmful c. always caused by a mutagen d. none of the options listed here

In a cross between a pure bred, red-eyed female fruit fly and a white-eyed male, what percent of the male offspring will have white-eyes? (White eyes are X-link

RupaBera RupaBera · Answer 1 · 2022-11-12T03:38:19-05:00

In a female metaphase I cell, 4 DNA would be anticipated.

How many chromosomes might one anticipate finding in the somatic cells of a female offspring's body?

In somatic cells, there are 23 pairs of chromosomes, one from each parent (the father) and one from the mother (from the mother). One pair of sex chromosomes and 22 matched pairs of autosomal chromosomes are present.

How many chromosomes should each gamete of that organism contain?

There are only 23 chromosomes in each egg and sperm cell. That's only half the number of chromosomes found in typical cells. A zygote, or cell containing 46 chromosomes (23 pairs), is created when an egg and sperm combine during fertilization.

To know more about metaphase visit:-

https://brainly.com/question/9360168

#SPJ4