garcia041685 garcia041685

31-10-2022
Biology

Answered

Some energy is released as unusable heat energy into the environment. 1st law of thermodynamics Energy can only be changed from one form to another. 1st law of thermodynamics Energy can't be created or destroyed. 1st law of thermodynamics

Answer :

lhchizobanjoku lhchizobanjoku

01-11-2022

Energy can neither be created nor destroyed, but it can be transferred. First law of thermodynamics.

What is energy?

This is the ability or capacity to do work. we know that the first law of thermodynamics explains energy conservation. thus, energy can neither be created nor destroyed.

Also, Zeroth's law of thermodynamics talks about the thermal equilibrium of two or more bodies. thus, if body A and Body B are in thermal equilibrium with body C. that body A, B, and C are all in thermal equilibrium with each other.

Again, the second law of thermodynamics says more about heat direction. Thus, heat cannot be transferred from a colder to a hotter body.

No, thermodynamics law supports the theorem in the question.

Learn more on

https://brainly.com/question/12292316

#SPJ1

Answer Link

Other Questions

all organisms face trade-offs that arise from the constraints that they face. one example of a constraint: energy spent on one task cannot be spent on another.

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

since most of the 100 species did not actually survive when they migrated, does this bodewell for species who have to leave a habitat when it is destroyed?

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

Okay, I need help with this assignment, worth 50 points, which is the max amount of points you can receive here, and I am willing to mark brainiest. I need to d

a compound that preents teh seperation of the homogous chromsoems in anaphase 1 is being studid. which fo the followign questions can be best answered during th

the following text applies to questions 47-49. over the past 60 years, many amphibian species have experienced significant population declines and some species

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

the arctic tundra has remained frozen for thousands of years but is slowing thawing as global temperatures increase. once thawed, the environment and ecosystems