rbagwell324 rbagwell324

29-10-2022
Biology

Answered

A student holds a mineral up to the light. She is most likely observing which property? (1 point)
O hardness
O luster
O cleavage
O tenacity

Answer :

Other Questions

Prokaryotic cells ________. (Choose all that apply.) Group of answer choices 1. are very large. 2. are less complex. 3. have many unique organelles. 4. make up

Prokaryotic cells ________. (Choose all that apply.) Group of answer choices A. are very large. B. are less complex. C. have many unique organelles. D. make up

what is the elevalation of point C and D

Match the term with its correct description. Group of answer choices Homeostasis [ Choose ] Hydrophillic [ Choose ] Hydrophobic [ Choose ] Passive transport [

Match it Up From your prior knowledge, match up the two types of reproduction with their characteristics and place the items in a Venn Diagram •Characteristics

Change any nucleotide between the Reading Frame (Between 'Start' and 'STOP' transcribing 5’ acgatgcattgtcccgcactgtaatat3’ 3’ tgctacgtaacagggcgtgactgcattata5’

23. The code for making proteins is carried to the ribosomes by a. tRNA b. DNA c. mRNA d. thymine

Question 5 Insert any nucleotide in the Reading Frame and show the new amino acid sequence after Transcribing. 5' acgatgcattgtccagcactgacgtaatata' 3' gatacgtaa

Grouper are a type of fish that often wait until they are around 20 years old to reproduce. Based on this, grouper could be considered -selected. A, r B. J C. K

Question 6 You are an ecologist researching divergent evolution on the Galapagos Islands. Which of the following might you be studying? O the processes by which