trynitee62 trynitee62

16-10-2022
Biology

Answered

What effect have at-home DNA tests had on law enforcement?
A More people's DNA data is in databases, so law enforcement has more
data to compare DNA samples with.
B More people know what DNA is now, so they are able to advise law
enforcement on using DNA to solve crimes.
C
More law enforcement officials can use DNA testing at home, which makes
better at their jobs.
D
More people know where their families come from, so they can be more
helpful in criminal investigations.

Answer :

Other Questions

Examine the image of a biological polymer below: How do the components of DNA circled in the diagram above determine DNA's physical properties? A. Glucose and p

The backbone of DNA and RNA is composed of ___ . DNA is double-stranded due to interactions between adenine, cytosine, guanine, and thymine, which are _____ . U

Which technology has been commonly utilized by scientists to manipulate heritable information by creating DNA fragments with ends that can join with other DNA f

Calculate the reaction rate in moles per hour for the data in the table. Time,seconds Amount of product(moles) 0---------------------------0 50----------------

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

2. Explain how the arrangement of the four chemicals that make up DNA determine how you as a human are different from a zebra.

Base your answers to questions 1 through 4 on the diagram below and your knowledge of Earth Science. The diagram represents nine positions of Earth in orbit aro

2. At which position might the Moon block part of the Sun, making a solar eclipse visible from Earth? (1) 7 (2) 2 (3) 9 (4) 4

Classification, or taxonomy is based on evolutionary relationships: Homologous structures, Embryology, and Molecular Biology (DNA). Why do you think that this w

Helppp 02.03 water quality virtual lab worksheet Analysis: Review your data carefully to make inferences about pollution. Answer these questions in complete sen