Jooshwa Jooshwa

15-10-2022
Biology

Answered

2. Explain how the arrangement of the four chemicals that make up DNA determine how you as a human are different from a zebra.

Answer :

Other Questions

Examine the image of a biological polymer below: How do the components of DNA circled in the diagram above determine DNA's physical properties? A. Glucose and p

Directions Now that the lab is complete, it is time to write your lab report. The purpose of this guide is to help you write a clear and concise report that sum

The backbone of DNA and RNA is composed of ___ . DNA is double-stranded due to interactions between adenine, cytosine, guanine, and thymine, which are _____ . U

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Determine whether the equation below has a one solutions, no solutions, or an infinite number of solutions. Afterwards, determine two values of a that support y

PLEASE ANSWER 15 POINTSBalance depends on information your brain receives from your eyes, muscles, and the semicircular canals in your ear. The 3 semicircular c

Helppp 02.03 water quality virtual lab worksheet Analysis: Review your data carefully to make inferences about pollution. Answer these questions in complete sen

50 POINTS!!!!!!! A dichotomous key works on the principle of asking yes-or-no questions about the organism. To identify it, the answers for that organism are th

What best describes mitochondrial dna (mtDNA)?

The table provided shows areas where sedimentary rock layers are exposed, as well as the environmental factors that produced the rock layers. Area Level of Ve