jdbekensn jdbekensn

15-10-2022
Biology

Answered

Examine the image of a biological polymer below:

How do the components of DNA circled in the diagram above determine DNA's physical properties?

A. Glucose and phosphate are linked by hydrogen bonds to nitrogenous bases.

B. Nitrogenous bases and phosphates link together to form a biological polymer.

C. Nucleotides form covalent bonds with phosphate to form DNA monomers.

D. Repeating units of phosphate and deoxyribose form the backbone of DNA.

Examine the image of a biological polymer below How do the components of DNA circled in the diagram above determine DNAs physical properties A Glucose and phosp class=

Answer :

Other Questions

What are the similarities between DNA and RNA molecules? A. A double stranded helix, a phosphate group, and a hexose sugar B. A nitrogenous base, a phosphate gr

Directions Now that the lab is complete, it is time to write your lab report. The purpose of this guide is to help you write a clear and concise report that sum

The table provided shows areas where sedimentary rock layers are exposed, as well as the environmental factors that produced the rock layers. Area Level of Ve

What makes water molecules polar? A.The atoms of a water molecule have linear bonds and equal electronegativities B. The ability to covalently bond to other wat

Question 7(Multiple Choice Worth 2 points) (02.07 MC) Which of the following steps is required after biological processes have broken down organic material in w

Please help!! I will give several points!!! (Use the link provided) List life forms present: Please go to this link: https://www.biointeractive.org/classroom-re

5. In a scientific investigation, a scientist is testing to see the effect of light intensity (strength of the light) on plant growth. During her investigation,

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Some ribosomes are free-floating in the cell. Others are bound to an organelle. Where are the bound ribosomes found? A. floating in the cytoplasm B. attached to

Matching: List in order the eukaryotic cell parts that a protein moves through as it is assembled, modified, and shipped to the correct location via the endomem