ygpfbz9zj9 ygpfbz9zj9

15-10-2022
Biology

Answered

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Answer :

Other Questions

in the meselson-stahl experiment, after the first round of dna replication, the model was eliminated because band(s) was/were seen in the tube afte

If the conservative model had been correct, how many generations of bacterial cell division would have had to pass before meselson and stahl would have observed

Each cell below is 25µm in length. The images were taken on medium power. What is the diameter of the medium power field of view?

50 POINTS!!!!!!! A dichotomous key works on the principle of asking yes-or-no questions about the organism. To identify it, the answers for that organism are th

The cytoplasm of a cell is a thick solution consisting of water and dissolved salts and proteins. A cell is placed in a beaker of distilled water, which is pur

place the following events in the correct order in which they occur in the cam pathway, beginning at the top with the entry of carbon dioxide into the leaf.

rite a brief summary of the process of photosynthesis. be sure to include a description of the reactants and products, the location of the process in the plant

8. when stuff binds to proteins, the proteins change shape. when the action potential reaches the sarcomere, it releases calcium which binds to the "bo

Directions Now that the lab is complete, it is time to write your lab report. The purpose of this guide is to help you write a clear and concise report that sum

the respiratory system and the system equally share the responsibility of supplying oxygen to, and eliminating carbon dioxide from, the body’s cells.