A spoonful of a white substance is mixed into a beaker of water to form a solution. The substance is either sugar or salt. Which step would be most useful for finding out whether sugar or salt is in the beaker?

Question

12-10-2022
Biology

Answered

A spoonful of a white substance is mixed into a beaker of water to form a solution. The substance is either sugar or salt. Which step would be most useful for finding out whether sugar or salt is in the beaker?

Answer :

Other Questions

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

routine monitoring of water in a reservoir has found a high count of e. coli. of the following, you would be most concerned that the contaminated water might al

in fruit flies red eye color (R) is dominant to white eyes (r) in a cross between two flies, 50% of the male and 50% of the female offspring had red eyes. The o

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

which of the following is thought to have been the first step in the origin of life? group of answer choices replication of primitive genes formation of polypep

old-growth forests can be described by which of the following group of answer choices a clear forest floor free of dead wood or debris are considered good choic

which of the following is not true of stem cells ?they can be used to synthesize proteins important in medicine they can divide indefinitely they are capable of

Which of the following would be an example of a biological influence into the development of a pathological fear of the sight of blood? a. The immediate assista

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

mickymike92 mickymike92 · Answer 1 · 2022-10-14T11:25:59-04:00

To determine whether the substance is sugar or water, get a battery and connect a wire to it to a light bulb. Allow the circuit to be completed by the solution; if the substance is water, the bulb will light up as salt is an electrolyte, but if it is sugar, the bulb will not light up as sugar is not an electrolyte

What are electrolytes?

Electrolytes are substances that when in the molten or solution form conduct electricity and are decomposed by the electricity passing through them.

Electrolytes are ionic compounds. Because the ions are not free to move when they are in the solid state, electrolytes do not conduct electricity as solids except they are molten or dissolved in water.

Learn more about electrolytes at: https://brainly.com/question/17089766

#SPJ1