boswellt9 boswellt9

01-04-2024
Biology

Answered

explain the similarity between the polymer structure of nucleic acids and the amino acid polypeptide chain

Answer :

Other Questions

CTGTTACTTTCAATCGTACACCAACACTGCTTTC Translate and transcribe this strand of DNA into mRNA and amino acids.

protein that consists of 33 amino acids would be coded for by a gene that is made up of how many bases??

What type of chemical reactions take place in electron transport chain

In the last two experiments, we treated the water and sample masses separately when calculating the heat transfer. In this experiment, the mass of the solution

explain similarities and differences between the transmission of mutations in prokaryotes and eukaryotes from generation to generation

Yes, there would be a noticeable change if 10% glucose is substituted with 10% orange juice. Glucose is a simple sugar, while orange juice contains a mixture of

How did mitosis differ between the plant and animal cells

explain the significance of cell cycle in living organisms

Describe the posistions of the bases and the phosphates in relation to the helix

imagine an enzyme is paralyzing a chemical reaction that joins together monomer subunits into a long chain (The subunits are forming polymers in the reaction) I