chafincole chafincole
  • 28-03-2024
  • Biology
Answered

CTGTTACTTTCAATCGTACACCAACACTGCTTTC
Translate and transcribe this strand of DNA into mRNA and amino acids.



Answer :

Other Questions

protein that consists of 33 amino acids would be coded for by a gene that is made up of how many bases??
the mass of the gene is 32400 units. the amount of introns is twice the number of exons. what is the mass of the protein encoded by this gene if the mass of the
Yes, there would be a noticeable change if 10% glucose is substituted with 10% orange juice. Glucose is a simple sugar, while orange juice contains a mixture of
१. Chromosomal Abnormality. Gender 2 3 5 6 7 8 9 10 11 12 前 i m m mj 13 14 15 16 17 18 *** WN 3 3 19 20 21 22 23 Disorder Name
What type of evidence is this?
Which of the vessicles below are made by the endomembrane system and contain proteins and/or lipids that will be dumped into the extracellular space by exocytos
Which of the following observations is an important component of the ecosystem at each stop along the elevational gradient? Soil characteristics Ambient cond
aly one ger, a as shown lf) will GENETIC MAKEUP OF A MOUSE POPULATION Genotype Phenotype BB Number of Individuals in Original Population Number of Individuals i